Apologetics - The Poached Egg

X-Birds: Genetic Mutations and the Evolution of a Species

 

X-Birds: Genetic Mutations and the Evolution of a Species

by Bree (with Greg West)

Yesterday, Greg sent me the following satirical story to review and I think that for the most part he’s spot on.

“I’m not anything even close to being a biologist (and after reading this, I’m sure many of our skeptic visitors will agree), but even so, I have endeavored to understand the concept of Neo-Darwinian evolution. I’m going to use the example of woodpeckers to demonstrate my understanding thus far of how it works…

Once upon a time there was a species of birds (for the sake of our story we’ll call them, ‘protopeckers’) that contentedly roosted in the forest and flew around eating the plentiful varieties of bugs that also lived in the forest. The protopeckers merely had to expend the effort of flying around and catching these bugs in their beaks or catch them off-guard crawling around on the forest floor. Life was pretty simple for the protopeckers; eat, sleep, drink, fly, mate— things were going well, and like I said, the protopeckers were about as content as any birds could be-- and they were also thriving, despite the existence of some larger birds that would occasionally eat one of them.

Then one day a natural disaster occurred. It was terrible for the protopeckers because this disaster killed off most of the bugs that were the major part of their diet. Those bugs that were not killed off ran away to another unknown part of the forest, far away from where the protopeckers lived. The only bugs that remained where the protopeckers lived where the ones that lived underneath the bark of trees or could actually burrow into the trees themselves.

The birds had never attempted to eat these particular bugs before because they were so much more difficult to get at than the bugs they had been previously eating. The few that had tried had ended up with bad concussions, severely bent beaks, or both, which resulted in brain damage or the inability to mate because potential mates were repulsed by their bent beaks.

But now, because of the shortage of any other food, all of the protopeckers were forced to make the attempt to get at these tree bugs. Things were no longer easy for the protopeckers, and they began to die off. The ones that didn’t die off right away were forced to mate with brain damaged protopeckers or ones with badly damaged beaks, and their offspring had even a harder time surviving than their parents did.

Fortunately, there was one protopecker that was born with some genetic mutations which caused him to look rather peculiar to his fellow protopeckers. His parents named him ‘Woody’. Woody’s mutations caused him to have a long narrow pointy beak which was also quite sturdy. These mutations also gave him an unusually long tongue, with which he could snatch the tree bugs out of their deep holes in the trees. Luckily, Woody also discovered that he could hammer away at a tree with his super-beak without getting a concussion because there was a strange piece of cartilage between his skull and his brain which prevented that from happening.

Since Woody was now the only protopecker that could reach the previously unreachable food he was able to survive, but because there was no food for the other protopeckers, they all began to leave in search of food. Woody now has to leave as well, because all good little protopeckers must mate and produce more little protopeckers.

Because of his peculiar appearance, Woody had to travel far and wide in search of a suitable mate. He was about to die of sheer loneliness when suddenly, in the distance, he heard a strange knocking noise: “rattattatatatattatattat!” At first he wasn’t sure what it was, but then he heard it again, closer this time: “rattattatatatattatattat!” And then he heard it again… and again! It reminded him of the exact same sound that he made when he was hunting and eating the tree bugs.

Woody followed the sound until he saw that it was being made by a beautiful… Woodpecker. She noticed Woody coming her way and it was love at first sight. Woody introduced himself and she told him that her name was Winnie. Woody and Winnie made lots of babies, now known as ‘Woodpeckers’, and lived happily ever after.”

Now obviously, this is a story. This is not how Woodpeckers actually evolved (although it could be, but research in 2006 even suggests that two species of woodpeckers found in North America and in Cuba are very distantly related, having diverged over 1 million years ago_­­­­­­¹­).

Let’s talk for a moment about adaptation. Woody has cartilage protecting his brain, and stronger beak, through a series of genetic mutations. First of all, as nice as that sounds, most mutations don’t just magically confer a really handy tool like that. Even the replacement of a single base pair can cause severe damage (just look at Cystic Fibrosis). If Woody actually had one useful mutation, it’s a miracle, but here, he has at least two, and didn’t die from the massive rearrangement of genes that must have taken place in his mother’s egg or father’s sperm, or both.

Don’t believe me? If you’ve heard of knockout mice, you might understand what I’m talking about. When researchers “knock out” a gene, they make use of some really neat machinery and physically remove a gene from an embryo (a gross oversimplification of the process). It’s not that simple though. They have to produce heterozygotes and then cross-breed them, hoping to produce a recessive offspring. Sometimes, the offspring simply aren’t there. What happened? They died in utero. Either they failed to develop, or a huge congenital deformity caused their untimely deaths.

The next bit of criticism we’ll see from our skeptics will tell us that we don’t understand how evolution works! It’s gradual change over time! Sure, I understand completely what it means. One bird had a teeny bit of extra cartilage. His children had a bit more cartilage, the next generation a bit more, etc. etc., until we have a bird with a massively large protrusion on his forehead. Okay, not really. But there’s a problem with that hypothesis. That one gene wouldn’t increase in frequency unless it had some function. Until it can confer function, it doesn’t increase fitness, and no increased fitness means no increase in mating behavior, which means no increase in gene frequency. And remember, we’re still assuming this mutation didn’t kill our bird to begin with. The point at which we pick Woody up in our story is past all of these gradual mutations, of course. He’s already an ancestor of the first mutated bird. Somewhere down the line, he and maybe a buddy or two have this weird cartilage, long beak, and long tongue. The rest of his family just thinks that he and these others are a little… weird looking. Which means no one would want to mate with him anyway.

Assuming the entire population of protopeckers is dying out, maybe all the males are gone except for Woody, it looks like now Woody’s fitness has drastically improved. He’s now hot stuff, and he has lots of babies. About half of them are blessed with Woody’s strange adaptations, and some of them survive. Two girls and a boy. And now these guys dominate the scene because they have improved “fitness” and the others don’t reproduce as much, if they even survive to childbearing age.

Another assumption that we should elaborate on is foraging behavior (finding food). If such a natural disaster occurred, the birds would start doing what's called sampling behavior. They had probably previously done this in order to find the cache of food supply they’ve already been making use of. They would search for food in new locations until they found them or died trying. Birds have the ability to remember where they sampled for food. When they do this, they systematically scan an area and remember where they found the food, and which area had the most food and was the closest or easiest to get to, etc.

Evolutionary ecologists have come up with formulas that mathematically calculate (model) how birds do this. But birds are not as smart as people - they just eat bugs, and keep eating bugs. In order to come up with a model, however, we have to do math (go figure). All of that gets very difficult to discuss… suffice it to say that the foraging behavior of birds is very complex. No one has really decided yet if behavior is a genetics thing or a learned thing. (Surprised?) So we can't really say for sure if birds learn their behaviors or know them by instinct. And we don't really know what drives instinct either… yet. (And it's my belief that we won't ever know. It's too complex and there are too many possible gene combinations to ever really study behavior without any other variables.)

When changes in behavior occur, it’s hard to know why. In general, “it is difficult to link genes with specific behaviors, especially in vertebrates” (2) which is why we use invertebrate models. Wait. So now, I’m studying the behavior of birds using fruit flies. Awesome. Because fruit flies and birds are just alike. Another problem is that sometimes behaviors aren’t all that variable (i.e. in our protopecker scenario above, all the protopeckers have similar behavior). Lack of variability also makes it difficult to study behaviors and their underlying genetic bases. Fortunately, we can engineer knockout mice and transgenic organisms to study behavior. Because transgenic organisms are just like “normal” organisms. Except that they have genes from other species.

Assuming all of these techniques are really telling us something relevant, we can learn how genetics drives behavior. Eventually. In the lab. But in natural environments, that’s where we come to the real difficulty. Studying behavior in natural environments and making inferences about evolutionary relationships from these studies is nearly impossible. It’s one thing to go bird-watching or bird-counting, and make an inference about the population’s movement, but another thing entirely to ascertain WHY they are feeding or moving or mating.

Now, back to Woody. Based on many studies of typical forest birds, we could say that Woody would probably not just up and leave his patch unless he A) couldn't get food, or B) couldn't mate. We’ve already assumed Woody had to leave due to the fact that he needed a mate. Once he found a mate and successfully reproduced, these birds would start an entirely new population of mutated protopeckers (woodpeckers). Mutation after mutation, eventually these birds would exhibit "speciation" - they are now a new species.

What does this all mean? Friends, there is no way to prove that woodpeckers received some mutations, either one bit at a time, or all at once, that conferred their ability to “peck wood.” Environmental changes as rapid as described here would most certainly result in the loss of that population. Slow changes in the environment would suggest that the population would move on to a new location in the process of sampling. So what really drove the evolution of the woodpecker to its current state? What would ever cause a bird to suddenly start to peck at the wood? If just one mutation were required to confer the extra cartilage, or lengthen the tongue, or strengthen the beak, could it happen? Over a long period of time?

My students all know about my scandalous love affair with proteins. Proteins are what makes us who we are – all of us, man and beast alike. Extra cartilage means that somewhere, a gene was changed, a protein was made differently, or a signaling pathway was modified – and all of these require proteins. Proteins are what makes the world go ‘round. Changing just one protein would require no less than seven gene mutations (3). Seven. That, my friends, is highly unlikely.

1 Fleischer et al. Mid-Pleistocene divergence of Cuban and North American ivory-billed woodpeckers. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1686174/?tool=pmcentrez

2 Behavioral Ecology, Danchin, Giraldeau, and Cezilly. 2007. Oxford Press.

3 Ann K. Gauger & Douglas D. Axe, "The Evolutionary Accessibility of New Enzyme Functions: A Case Study from the Biotin Pathway," BIO-Complexity, Vol. 2011(1) (2011).

What’s the big deal? Proteins

 

What’s the big deal? Proteins

by Bree

This post is the first in a series which will attempt to explain to the non-science nerd what us science nerds get all excited about. In this edition, we will look at proteins and how they are made. Disclaimer: This is written for someone who really has no idea what DNA and proteins are all about. I’ve simplified language and processes to that point. If you would like to discuss these things with me on a more in-depth level, I’m all for it!

Most people would agree that they’ve heard this common phrase a time or two: “It’s in my genes!” But what exactly does that mean? Sure, we have these things called genes, and they are found somewhere in the magical land of DNA. And proteins? What do proteins have to do with anything?

Proteins are what it’s all about. You are who you are because of your proteins. I’ll start off here the same way I do with my biology students. You have a secret code. You need to decipher the code in order to be able to read a message in plain English. At this point, I actually hand them a piece of paper and a secret message decoder. The message looks something like this:

AAUAGAGGGCCCUUUUUUAAUAUUGGCGGCAAUAUAAAU

(I just made that up. It’s meant to represent an RNA strand, but I promise there is no hidden agenda! I was too lazy to look up a real one!)

They also receive an amino acid chart, like this:

This chart is the “real” RNA decoding chart. This is what scientists use to determine the order of amino acids found in a protein. So, you could take the “secret code” up there at the top, and “decode” it. If we did, we’d end up with this:

Asn Arg Gly Pro Phe Phe Asn Ile .... etc.

What I do then is just assign an English letter (A, B, C, D etc.) to each amino acid, and when they’re done, they have a message they can read! It’s fun. I usually say things like “Biology Rocks” or something easy like that. Occasionally I say things like “You like Boogers” but only once in a while. Gotta keep it interesting!

So you’re probably still wondering what the point is, right? Well, here’s the deal.

DNA is found in the nucleus of the cell. It is a double helix shape, wound tightly around tiny molecules called histones. Think of spools of thread. This compound of histones and DNA is coiled tightly into a substance called chromatin. It becomes even further compressed into chromosomes during a process called mitosis. When the cell is ready to make a protein (this is happening constantly in a typical cell), a small section of DNA is selected. This small section is called a gene. The gene is exposed to the cellular machinery (which is made of proteins) by uncoiling from the histone. Then, a copy of this gene is made. It’s not just a regular copy though, it is slightly different. Instead of a double-stranded DNA copy, a single-stranded RNA copy is made.

*Let’s take a breath here. Are you confused yet? I hope not, but we are capable of thinking. These molecules we’re speaking of are inanimate objects. They are nonliving, globs of molecules. Just keep that in mind.*

Alright. We left off above with an RNA copy of the DNA code. This RNA copy is now taken out of the nucleus into the gelatinous cytoplasm of the cell. Floating around here are lots of things, but we are interested in two items: ribosomes and amino acids. Amino acids are the building blocks of proteins. (Just memorize that sentence. That’s what I tell my kids.) And the ribosome is what assembles the amino acids, in just the right order, by reading the RNA “code” that’s just been received from the nucleus. A protein is, at its core, a long strand of amino acids joined end-to-end.

Here’s the manipulative we use in the biology classroom when teaching this concept.

Now, after this chain is made, it coils upon itself over and over, forming eventually what we call a tertiary structure. The overall shape of the protein is very important. Even being wrong by one amino acid could cause the protein to be completely non-functioning. You see, many proteins become something called enzymes, which are used in nearly every chemical reaction in the cell, and make use of a lock-and-key mechanism. They must fit exactly with the molecules they are to work with. One change in shape and they are non-functioning. Inactive. And without them, we’re dead. Without them, we’d never develop in our mothers’ wombs. Another function of proteins? Antibodies. You’ve heard of antibodies - immunity. Another subject for another day.

Here’s the thought I’d like to leave you with for today. We’ve barely scratched the surface of this process. We’ve ignored many of the intricacies of genetics. I haven’t spoken of introns and exons, splicing, posttranscriptional modification of mRNA, etc. What I’ve tried to do is present a very basic explanation of how proteins are made. There are thousands of these protein micromachines that are necessary for cell survival. Even the loss of just one can cause cell death. So where did all this complexity come from? And if just one mistake means certain death, where did the mechanisms come from that double check each and every step of the process? What about the original proteins needed to read the DNA and RNA? Where did they come from? How did ALL the pieces needed to form even just one simple bacterium come together, at the same time and in the same place, and become something living? It’s sort of like asking if the chicken or the egg came first.

Evolutionists claim that the cell evolved from nothing. Just this morning, I read an article discussing this very molecule pictured - hemoglobin - the oxygen carrying molecule found in red blood cells. The article stated that because we find a derivative of hemoglobin in both animals and plants, we see that hemoglobin is an ancient form, a relic of the past, of when oxygen was thought to be a toxin to the fledgling life on earth. (They do mention that the animal and plant forms of hemoglobin differ by around 80%, but that’s not really important, they’re both hemoglobin, right?) We’ve even discovered a species of icefish that completely lacks hemoglobin. Upon examination of the genome of this fish, we see that complete introns are missing - as if they’d been just ... deleted. Icefish don’t need hemoglobin because the water in which they live (very cold water) is oxygen-rich. Interestingly, the author uses this argument to show that we clearly have common ancestry, all the way back to when the icefish (of which there are now 15 species) diverged. I propose that the gene for hemoglobin is missing from icefish, not because it was deleted by mutation, but because it was not needed to begin with.

Next time: The proteasome.

Breeis a high school life sciences teacher and graduate student in Biological Sciences, focusing in Genetics.  Her goal is to be able to equip Christian educators in presenting controversial topics in science effectively without causing students to stumble in their faith, while providing answers to common questions students have about evolution, the age of the earth, the size of the universe, and biological systems as they relate to the Creation.

Evolution Doesn’t Matter

 

Evolution Doesn’t Matter

by Bree

As a child, I always wanted to know how things worked. I would take apart mechanical things and put them back together. When our washing machine broke down, my brother and I took it apart. It was awesome! I was thrilled to know about each part found inside.

Nowadays, it’s not washing machines I am interested in as much as the inner workings of the human body and of the cells it is comprised of that make it function. I find it all endlessly fascinating. As a graduate student in biology, I am bombarded on a daily basis with instances of amazing machines both great and small, all found within living systems. Yet each text, each lecture, and each podcast, reveals the same awe but for a different reason. “This mechanism evolved”, Is a phrase I hear over and over.

As a Christian, I can say that it isn’t easy to sit and listen to my professors (most of whom I genuinely like and think are very intelligent people doing great work in science) and not speak up for what I believe in. I tell myself that soon the time will come when I will feel equipped to take on the debate, and be able to debunk anything they can say back to me. But I realized today that's probably not going to happen.

I just finished reading an interesting article by Ken Miller supposedly refuting Michael Behe's irreducibly complex flagellum and I can't find fault with anything that was said, but I’m not an expert on the flagellum. It might appear to the untrained that Miller’s refute is accurate. There are many scholarly articles out there supposedly explaining the evolution of one cellular mechanism or another. We can split hairs over which cellular machines are irreducibly complex and which aren't - or which ones have or haven't been proven to be. Let me be lucid - the arguments presented as to how the flagellum could have evolved might be valid, but they are not the only possible solution. Rather than taking on the argument over a flagellum, I'll take on a bigger argument. Once a person takes a rather large step backwards and says to himself, "Why?" instead of "How?" it all becomes very clear.

Why are we the way we are? Why are there humans? Can anyone answer this question? Aside from unabashedly stating, "Because of the love of God" there really isn't a good answer. One of my texts from last semester suggested that we are little more than a vessel by which genes are passed down from generation to generation, becoming immortal. Really? That's depressing. You're telling me that the purpose of life is to ensure the persistence of a gene? An inanimate, lifeless molecule 'wants' to survive? What a sad existence.

If we look instead to the greatest story ever told, we see a loving God who creates humans beings in His image. He gives them free will, so that they can choose to love Him back, because without the freedom to choose, any allegiance they show is folly. They fall and are exiled. But God loves them anyway. We see God continually giving His favor and counsel to humans, throughout all of history. We see God telling His people how they should worship Him, what they can do to obtain His favor. We see Him taking vengeance on wickedness and we see His grace and mercy. He promises His people that He will send someone to eliminate death forever - the ultimate sacrifice. This sacrifice will once and for all take the place of animal sacrifices and burnt offerings. And all a person has to do to receive this ultimate grace is to accept it. Freely. The Story isn't over yet. We are still here. And it's our job and calling to spread the word, telling everyone the story, so that they too might be part of it. It's a great story, isn't it?

So why doesn't evolution matter? I don't know that we will ever be able to 'prove' that evolution isn’t true, just as those who'd like to disprove God’s existence will never be able to do so. There are many arguments out there. Irreducible complexity, fossils, arguments from ignorance… we could go on and on and discuss it until the cows come home. Many of these 'discussions' might end in harsh words and bitter feelings. It's still a Catch-22, but that's the way the story goes. There is plenty of evidence out there in support of the existence of God. We really don't need absolute proof that He created us because the evidence is all around us and it is plain to see. All you have to do is open your eyes and look.

 

Bree, the latest addition to The Poached Egg writing team, is a high school life sciences teacher and graduate student in Biological Sciences, focusing in Genetics. Her goal is to be able to equip Christian educators in presenting controversial topics in science effectively without causing students to stumble in their faith, while providing answers to common questions students have about evolution, the age of the earth, the size of the universe, and biological systems as they relate to the Creation.