What’s the big deal? Proteins

by Bree

This post is the first in a series which will attempt to explain to the non-science nerd what us science nerds get all excited about. In this edition, we will look at proteins and how they are made. Disclaimer: This is written for someone who really has no idea what DNA and proteins are all about. I’ve simplified language and processes to that point. If you would like to discuss these things with me on a more in-depth level, I’m all for it!

Most people would agree that they’ve heard this common phrase a time or two: “It’s in my genes!” But what exactly does that mean? Sure, we have these things called genes, and they are found somewhere in the magical land of DNA. And proteins? What do proteins have to do with anything?

Proteins are what it’s all about. You are who you are because of your proteins. I’ll start off here the same way I do with my biology students. You have a secret code. You need to decipher the code in order to be able to read a message in plain English. At this point, I actually hand them a piece of paper and a secret message decoder. The message looks something like this:

AAUAGAGGGCCCUUUUUUAAUAUUGGCGGCAAUAUAAAU

(I just made that up. It’s meant to represent an RNA strand, but I promise there is no hidden agenda! I was too lazy to look up a real one!)

They also receive an amino acid chart, like this:

This chart is the “real” RNA decoding chart. This is what scientists use to determine the order of amino acids found in a protein. So, you could take the “secret code” up there at the top, and “decode” it. If we did, we’d end up with this:

Asn Arg Gly Pro Phe Phe Asn Ile …. etc.

What I do then is just assign an English letter (A, B, C, D etc.) to each amino acid, and when they’re done, they have a message they can read! It’s fun. I usually say things like “Biology Rocks” or something easy like that. Occasionally I say things like “You like Boogers” but only once in a while. Gotta keep it interesting!

So you’re probably still wondering what the point is, right? Well, here’s the deal.

DNA is found in the nucleus of the cell. It is a double helix shape, wound tightly around tiny molecules called histones. Think of spools of thread. This compound of histones and DNA is coiled tightly into a substance called chromatin. It becomes even further compressed into chromosomes during a process called mitosis. When the cell is ready to make a protein (this is happening constantly in a typical cell), a small section of DNA is selected. This small section is called a gene. The gene is exposed to the cellular machinery (which is made of proteins) by uncoiling from the histone. Then, a copy of this gene is made. It’s not just a regular copy though, it is slightly different. Instead of a double-stranded DNA copy, a single-stranded RNA copy is made.

*Let’s take a breath here. Are you confused yet? I hope not, but we are capable of thinking. These molecules we’re speaking of are inanimate objects. They are nonliving, globs of molecules. Just keep that in mind.*

Alright. We left off above with an RNA copy of the DNA code. This RNA copy is now taken out of the nucleus into the gelatinous cytoplasm of the cell. Floating around here are lots of things, but we are interested in two items: ribosomes and amino acids. Amino acids are the building blocks of proteins. (Just memorize that sentence. That’s what I tell my kids.) And the ribosome is what assembles the amino acids, in just the right order, by reading the RNA “code” that’s just been received from the nucleus. A protein is, at its core, a long strand of amino acids joined end-to-end.

clip_image004

Here’s the manipulative we use in the biology classroom when teaching this concept.

clip_image006Now, after this chain is made, it coils upon itself over and over, forming eventually what we call a tertiary structure. The overall shape of the protein is very important. Even being wrong by one amino acid could cause the protein to be completely non-functioning. You see, many proteins become something called enzymes, which are used in nearly every chemical reaction in the cell, and make use of a lock-and-key mechanism. They must fit exactly with the molecules they are to work with. One change in shape and they are non-functioning. Inactive. And without them, we’re dead. Without them, we’d never develop in our mothers’ wombs. Another function of proteins? Antibodies. You’ve heard of antibodies – immunity. Another subject for another day.

Here’s the thought I’d like to leave you with for today. We’ve barely scratched the surface of this process. We’ve ignored many of the intricacies of genetics. I haven’t spoken of introns and exons, splicing, posttranscriptional modification of mRNA, etc. What I’ve tried to do is present a very basic explanation of how proteins are made. There are thousands of these protein micromachines that are necessary for cell survival. Even the loss of just one can cause cell death. So where did all this complexity come from? And if just one mistake means certain death, where did the mechanisms come from that double check each and every step of the process? What about the original proteins needed to read the DNA and RNA? Where did they come from? How did ALL the pieces needed to form even just one simple bacterium come together, at the same time and in the same place, and become something living? It’s sort of like asking if the chicken or the egg came first.

Evolutionists claim that the cell evolved from nothing. Just this morning, I read an article discussing this very molecule pictured – hemoglobin – the oxygen carrying molecule found in red blood cells. The article stated that because we find a derivative of hemoglobin in both animals and plants, we see that hemoglobin is an ancient form, a relic of the past, of when oxygen was thought to be a toxin to the fledgling life on earth. (They do mention that the animal and plant forms of hemoglobin differ by around 80%, but that’s not really important, they’re both hemoglobin, right?) We’ve even discovered a species of icefish that completely lacks hemoglobin. Upon examination of the genome of this fish, we see that complete introns are missing – as if they’d been just … deleted. Icefish don’t need hemoglobin because the water in which they live (very cold water) is oxygen-rich. Interestingly, the author uses this argument to show that we clearly have common ancestry, all the way back to when the i
cefish (of which there are now 15 species) diverged. I propose that the gene for hemoglobin is missing from icefish, not because it was deleted by mutation, but because it was not needed to begin with.

Next time: The proteasome.

Breeis a high school life sciences teacher and graduate student in Biological Sciences, focusing in Genetics.  Her goal is to be able to equip Christian educators in presenting controversial topics in science effectively without causing students to stumble in their faith, while providing answers to common questions students have about evolution, the age of the earth, the size of the universe, and biological systems as they relate to the Creation.

The Poached Egg Apologetics